image05 image06 image07 image08 image09 image10

About

Popular Posts

Popular Posts

Powered by Blogger.

Popular Posts

Follow us on facebook

Contact Form

Name

Email *

Message *

Contact Us

Author

Discover ℭP Podcast

Discover ℭP Podcast
Listen to SP Reveal Previews

DON'T MISS THE TIME TRAVEL REVEAL!

DON'T MISS THE TIME TRAVEL REVEAL!
You'll never guess where this REVEAL will go! Here's a Teaser

2018 TEASER: The X-Files Gris

2018 TEASER: The X-Files Gris
If the X-Files Noir were paranormal sightings and X-Files Blanc are records of UFO activity. Then what will Gris be?

ALL NEW

Take A Look Inside NOIR The X-Files

Take A Look Inside NOIR The X-Files
While you wait for The X-Files Gris.

Monday, January 15, 2018

Topics: , , ,

Time Traveler's Conspiracy

THIS POST WILL EXPLAIN AND REVEAL THE TIME TRAVELERS SCIENCE TO THE WORLD.

As with many alleged time travelers from the future, John Titor came with a load of predictions about the world to come. Civil war, technological catastrophe and an outbreak of a deadly virus. Now in the year 2018, a new "Time Traveler" has come to give us his own remarkable story as well as a glimpse of our future. But could this TIME Traveler from the Year 6000 be telling the truth? Or was the experiment an out of body experience only known as "soul traveling" by the ancients.



- PREVIEW -
 TIME TRAVELER'S CONSPIRACY



- PART I -
THE TIME MACHINE 



In the year 2014, SP UNVEILED THE BIZARRE SEARCH FOR TIME TRAVELERS!


Astrophysicist Robert Nemiroff and his students were playing cards (for chips) last summer, chatting about Facebook. They wondered: If there were time travelers among us, would they be on social media? How would you find them? 


[source]


“We had a whimsical little discussion about this,” said Nemiroff, a professor at Michigan Technological University. The result was a fun-but-serious effort to tease out travelers visiting from the future by sifting through the Internet. 



Searching for Time Travelers, Scientists Look to Social Media
 
Time travelers, if they exist amongst us, have yet to betray their period-hopping ways online, according to a fun, new study aimed at finding visitors from another time, based on their digital footprints.
[source]

Searching the Internet for evidence of time travelers: MUT

Time travel has captured the public imagination for much of the past century, but little has been done to actually search for time travelers. Here, three implementations of Internet searches for time travelers are described, all seeking a prescient mention of information not previously available. The first search covered prescient content placed on the Internet, highlighted by a comprehensive search for specific terms in tweets on Twitter. The second search examined prescient inquiries submitted to a search engine, highlighted by a comprehensive search for specific search terms submitted to a popular astronomy web site. The third search involved a request for a direct Internet communication, either by email or tweet, pre-dating to the time of the inquiry. Given practical verifiability concerns, only time travelers from the future were investigated. No time travelers were discovered. Although these negative results do not disprove time travel, given the great reach of the Internet, this search is perhaps the most comprehensive to date.


Soul Traveling with Nikola Tesla 
(Time Machine name)



 What's different this time?  


S.C.I.E.N.C.E. and it's about to break open a wormhole of questions.


"I'm Brian Greene, professor of physics and mathematics at Columbia University and co-founder of the World Science Festival. It's critical that you realize that there are two types of time travel, and they are radically different. Time travel to the future? Definitely possible. We know how to do it because Einstein showed us the way over a hundred years ago."



TIME TRAVELER: Someone who travels through the past and present. Whether it is through an object, at will, or using worm holes. A time traveler can visit any time in the past, present, or future.



"You'll never guess where this 
 TIME TRAVEL REVEAL will go!"




- WATCH VIDEO -



Teaser ACCESS: Time Traveler's Conspiracy  



GET YOUR 2018 MEMBERSHIP 

Tuesday, January 9, 2018

Topics: , , , , ,

MOON H-O-L-O

THIS POST WILL EXPLAIN AND REVEAL THE MOON HOLOGRAM TO THE WORLD.


It's common knowledge that earth's only companion, the moon, is real. There it is, big and bright, careening across the sky in a dark orbit thousands of miles away. But if we're living in a simulation could our own Moon be a projection? And if so, did mankind stumbled upon its secret in 1969 and 1962? Or has its other-worldly nature been with us all along?



MOON H-O-L-O



"A Black Mirror X-Files MOON REVEAL Is ARRIVING!"


Last Year 2017, SP Unveiled

THE MOON MATRIX

 

In A SP REVEAL ENTITLED: "1969 Moon Landing"

We learned the Bible Code Matrix surrounding Earth's Moon Conspiracy It had the following words: Each had its own Revelation.

 

KEY: FOUR, SEVEN 1947?

What really happened on that warm July, Roswell night in 1947? Surely you have heard of the incident in Roswell New Mexico that has remained a controversy till this day. The Alien bodies that were recovered from the Roswell crash site were rumored to have been pronounced deceased on the scene and taken back to Area 51 for autopsies. But this may not have been the truth! According to UFOlogists Aliens do not die. 

*Alien-Tech May Have Helped Apollo 11 Surpass the Radiation!

 

KEY: REAL/HOAX

According to this video about Orion Test Flight, the radiation of the Van Allen belt is so severe that it could effect the navigation system and that they would not send people through it until they "solve this issue." 



1962 Secret Moon SHOCKING Discovery


The reason for the abandonment of THE MOON is more {shocking, insane, crazy} than anything you could ever imagine, and connects well enough to our Future.
Before Elon Musk released his "Simulation Universe Theory" to the world. There was . . .
The Holographic Universe.

1969 Holographic Universe Then.
2018 Holographic Universe Now
.

 Fans of The Matrix perked up at the prospect that we might be living inside a giant computer simulation when Tesla and SpaceX founder Elon Musk raised the hype during the 2016 Code Conference, saying it was entirely possible that we exist inside a simulated universe.

 

I WANT TO BELIEVE.

You won't believe what Mankind stumbled upon in 1969!




"The theories are varied, numerous, and almost impossible to understand because many people on Earth have at best a marginal connection with reality. Some claim that the moon is a "hollowed out planetoid" inhabited by alien beings, while others theorize that what we know to be the moon is actually a hologram, behind which the government performs shady experiments on a different moon-like planet. Others claim that the moon is real but not what we thought . . ." 


One thing is for sure, after THIS REVEAL 
you won't be looking at THE MOON with the same mind.


Science:
 "We see with our brains, not with our eyes" - University of Edinburgh



THE SMOKING EVIDENCE:

It started months later, same year?!!


A true "modus operandi" for the 1969 Moon Landing Hoax?!

Moon landing conspiracy theories claim that some or all elements of the Apollo program and the associated Moon landings were hoaxes staged by NASA, possibly with the aid of other organizations. The most notable claim is that the six manned landings (1969-72) were faked and that 12 Apollo astronauts did not actually walk on the Moon.

QUESTION:  What would cause HUMANKIND to come together and conspire a Hoax for the masses?



Conspire: (of events or circumstances) seem to be working together to bring about a particular result, typically to someone's detriment.


ANSWER: A DISCOVERY that is too un·be·liev·a·ble to fathom.

I DON'T BELIEVE.

 

TOP SECRET TREATY BETWEEN THE GREYS, RUSSIA AND THE U.S. IN 1942


God made two great lights,


After the incident, the treaty was revised.

AND THE FINAL TEASER COMES FROM ABOVE:  Genesis


God made two great lights--the greater light to govern the day and the lesser light to govern the night - Genesis 1:16.




Lights = ma'owr =  Luminary

mâʼôwr, maw-ore'; or מָאֹר mâʼôr; also (in plural) feminine מְאוֹרָה mᵉʼôwrâh; or מְאֹרָה mᵉʼôrâh; from H215; properly, a luminous body or luminary, i.e. (abstractly) light (as an element); figuratively, brightness, i.e.cheerfulness; specifically, a chandelier:—bright, light. 



H.o.l.o.gram: a three-dimensional image formed by the interference of light beams from a laser or other coherent light source


- WATCH VIDEO -



Teaser ACCESS MOON H.O.L.O



GET YOUR 2018 MEMBERSHIP

Friday, January 5, 2018

Topics: , , ,

Rumors of War

THIS POST WILL EXPLAIN AND REVEAL THE PREDESTINED RUMORS OF WAR TO THE WORLD.


If there was a message in North Korea's launch of a new missile capable of reaching anywhere in the United States, it was that America's strategy toward that country is failing - and that war may be looming. But will the Atomic pulse come on an impulse of power? 
Or could its future-impact on our world be preordained?



You will hear of wars and rumors of wars, but see to it that you are not alarmed. Such things must happen, but the end is still to come - Matthew 24:6.


 
In 1969, President Richard Nixon was tempted to strike at North Korea after it shot down an American spy plane, killing all 31 people aboard. Aides warned that any military strike could escalate into all-out war, and eventually Nixon backed down. Ever since, American presidents have likewise been periodically tempted to strike North Korea after one provocation or another, but have ended up showing restraint for fear of a cataclysmic war.



"Why should we not be alarmed?!"



Is our world a simulation? Why some scientists say it's more likely than not.
IF TRUE, This changes everything.


According to this week’s New Yorker profile of Y Combinator venture capitalist Sam Altman, there are two tech billionaires secretly engaging scientists to work on breaking us out of the simulation. But what does this mean? And what evidence is there that we are, in fact, living in The Matrix?  One popular argument for the simulation hypothesis, outside of acid trips, came from Oxford University’s Nick Bostrom in 2003 (although the idea dates back as far as the 17th-century philosopher René Descartes). In a paper titled “Are You Living In a Simulation?”



BEHIND THE POSTER:
Chess is a game played between two opponents on opposite sides of a board containing 64 squares of alternating colors. Each player has 16 pieces: 1 king, 1 queen, 2 rooks, 2 bishops, 2 knights, and 8 pawns. The goal of the game is to declare Checkmate. In this case, what surrounds the board-game counts.



Read ► Rumors of War









(2018) Rumors of Wars REVEAL KEYWORDS: Earth, Space-time, Atoms, Warfare, Weapons, Darkness, Light, Past, Future, Present, Atomic, Science, Cataclysm

Monday, January 1, 2018

Topics: , ,

Digital DNA

THIS POST WILL EXPLAIN AND REVEAL A FUTURE DIGITAL DNA TO THE WORLD.


 Deoxyribonucleic acid (DNA) is a nucleic acid that contains the genetic instructions for the development and function of living things. All known cellular life and some viruses contain DNA. The main role of DNA in the cell is the long-term storage of information. In the not-too-distant future, mankind may be able to extend their existence to a digital dimension.
That is, if they can bypass the "God Program" hidden within our DNA.



"2018's FIRST REVEAL is all about our DNA."

In the not-too-distant future.

Humankind will try to "create" a digital blueprint.


 "DNA has many advantages for storing digital data. It’s ultracompact, and it can last hundreds of thousands of years if kept in a cool, dry place."


"Dr. Francis Collins, director of the Human Genome Project (that mapped the human DNA structure) said that one can "think of DNA as an instructional script, a software program, sitting in the nucleus of the cell." It's almost-impossible to replicate."


 "Now, researchers report that they’ve come up with a new way to encode digital data in DNA to create the highest-density large-scale data storage scheme ever invented. Capable of storing 215 petabytes (215 million gigabytes) in a single gram of DNA."


- Tweet -



Get Your 2018 Membership
 

DNA Super-Intelligence Is Just A Front?!



"When Humankind BREAKS the DNA CODE. (sentient) DNA will be Ready!"
 
 
 

1 gram of DNA 215

215 million

 

 Deoxyribonucleic acid (DNA) is a nucleic acid that contains the genetic instructions for the development and function of living things. All known cellular life and some viruses contain DNA. The main role of DNA in the cell is the long-term storage of information.

 

My Avatar, Myself - NEVER

 

 Humanity has a data storage problem: More data were created in the past 2 years than in all of preceding history. And that torrent of information may soon outstrip the ability of hard drives to capture it. Now, researchers report that they've come up with a new way to encode digital data in DNA to create the highest-density large-scale data storage scheme ever invented. Capable of storing 215 petabytes (215 million gigabytes) in a single gram of DNA.

 

A SECRET OF LIFE


Over millennia, nature has created an incredible information storage medium - DNA. It already stores genetic information, blueprints for building proteins, but DNA can be used for many more purposes than just that. DNA is also much denser than modern storage media: The data on hundreds of thousands of DVDs could fit inside a matchbox-size package of DNA.
DNA is also much more durable - lasting thousands of years - than today's hard drives, which may last years or decades. And while hard drive formats and connection standards become obsolete, DNA never will, at least so long as there's life.
 

SHOCKING SCIENCE

 DNA cloning is a molecular biology technique that makes many identical copies of a piece of DNA, such as a gene. In a typical cloning experiment, a target gene is inserted into a circular piece of DNA called a plasmid.

In the future, THIS cloning will (try to) go Digital.
 
 
 
If the computational hypothesis of brain function is correct, it suggests that an exact replica of your brain will hold your memories, will act and think and feel the way you do, and will experience your consciousness - But what about our DNA?
 
 

SILICON IMMORTALITY :

DOWNLOADING CONSCIOUSNESS INTO COMPUTERS

 While medicine will advance in the next half century, we are not on a crash-course for achieving immortality by curing all disease. Bodies simply wear down with use. We are on a crash-course, however, with technologies that let us store unthinkable amounts of data and run gargantuan simulations. Therefore, well before we understand how brains work, we will find ourselves able to digitally copy the brain's structure and able to download the conscious mind into a computer.
 
It may be impossible to replicate our DNA . . . digitally.  

Storing Data in DNA Brings Nature into the Digital Universe:

They first converted the files into binary strings of 1s and 0s, compressed them into one master file, and then split the data into short strings of binary code. They devised an algorithm called a DNA fountain, which randomly packaged the strings into so-called droplets.

 
 

SINCE THE YEAR 2012

Scientists have been storing digital data in DNA since 2012.

Harvard University geneticists George Church, Sri Kosuri, and colleagues encoded a 52,000-word book in thousands of snippets of DNA, using strands of DNA's four-letter alphabet of A, G, T, and C to encode the 0s and 1s of the digitized file.
 
 

DNA Super-Intelligence Is Just A Front:

British philosopher, Dr. Antony Flew, was a leading spokesperson for atheism, actively involved in debate after debate. However, scientific discoveries within the last 30 years brought him to a conclusion he could not avoid. In a video interview in December 2004 he stated, "Super-intelligence is the only good explanation for the origin of life and the complexity of nature."1 Prominent in his conclusion were the discoveries of DNA  --- But there's a more deeper layer to our DNA that has not been uncovered. Its sheer magnitude

ACCTGGCCTGACACCTTCGCACC

Project: USS Callister

 

BLACK MIRROR SPOILER

Using the DNA of his colleagues, he has uploaded copies of their consciousnesses into the game and trapped them there, forever the slaves to his twisted digital vision.

 

How realistic is the futuristic technology in "Black Mirror"?

 

It's very, scary REAL.

 

DNA to harness one's consciousness?

Mike: I feel like if we're at a point where we can instantaneously analyze someone's DNA and copy it well enough to mimic their consciousness, we'd probably have achieved the singularity and be able to upload our own minds into the cloud.

Throw 3D-scanning technology into the mix and I could easily see something like this existing in the future, without the need for literally replicating us through our DNA.

Source: Quartzy

DNA to Infinity

 

DNA is made up of four chemicals, abbreviated as letters A, T, G, and C. Much like the ones and zeros, these letters are arranged in the human cell like this: CGTGTGACTCGCTCCTGAT and so on. The order in which they are arranged instructs the cell's actions.

What is amazing is that within the tiny space in every cell in your body, this code is three billion letters long!!
 
To grasp the amount of DNA information in one cell, "a live reading of that code at a rate of three letters per second would take thirty-one years, even if reading continued day and night."
So imagine, "Downloading/Uploading" THAT information to the cloud.


The U.S. Gov. is able to identify everyone in our country by the arrangement of a nine-digit social security number. Yet, inside every cell in you is a three-billion-lettered DNA structure that belongs only to you. 


So GOD created a "security" that is virtually unbreakable for us mortals.
 
 Its sheer size!



ACCESS: Digital DNA

Saturday, December 23, 2017

Topics: , , , ,

Into The Force

THIS POST WILL EXPLAIN AND REVEAL THE FORCE REALM TO THIS WORLD.

The Force is a metaphysical and ubiquitous power in the Star Wars fictional universe. It is wielded by characters in the franchise's films and in many of its spin-off books, games, and comics. In the story, the Jedi utilize the "light side" of the Force, while the Sith exploit what is known as the "dark side". The Force has been compared to aspects of several world religions, and the phrase "May the Force be with you" has become part of the popular culture vernacular. But is there a mystery within its "dimensional" walls that could be uncovered? And if so, has FOX given us the beginning of its secrets with Luke Skywalker's path to Nirvana? Could it be possible that all the JEDI knowledge is inside the Force?


"The Star Wars Episode IX spoiler is right in the title. 
Audiences will be taken for a ride into the Force."

But if you're not here for the Spoiler and want the REVEAL instead: 


Hold on to your brain-waves... 
It's going to get mind-blowing.



- PART I -
THE SECRETS OF THE FORCE GHOST


"The Final REVEAL of 2017 is about the Force that indwells everything."


Go. Watch.
 STAR WARS EPISODE VIII 


George Lucas created the concept of the Force to address character and plot developments in Star Wars (1977). He also wanted to "awaken a certain kind of spirituality" in young audiences, suggesting a belief in God without endorsing any specific religion.


WARNING: SPOILERS AHEAD

- WATCH VIDEO -


"As I was watching Luke Skywalkers' SW VIII final scene, It struck me like a bolt of lightning, a thought that could really bring the beginning of the end for IX to the fans."


I thought to myself: "So, that's how he's going to be returning..."



So, How Is It Possible That SP Knows about Star Wars IX (pre-production and all).

Let's Look Around the World Wide Internet.




The name of the next "Star Wars" movie has been unveiled and while many fans are freaking out over the logo's ominous red font or exactly what "The Last Jedi" may mean, a few "Star Wars" fans noticed that we had a glimpse of the Episode VIII title a long time ago.   The name of the next movie has been hiding in plain sight in front of fans' eyes since "Star Wars: Episode VII" was released in 2015.



And in Star Wars Episode IX the "red" turns green because it's about . . . Yoda. (Or the life Force that embodies all living things — which both the Jedi and Siths want to harness for themselves).




“Death is a natural part of life. Rejoice for those around you who transform into the Force. Mourn them do not. Miss them do not. Attachment leads to jealously. The shadow of greed, that is.” - Yoda


For the living know that they will die, but the dead know nothing; they have no further reward, and even their name is forgotten - Ecclesiastes 9:5.


NOT EXACTLY, IN THE NETHERWORLD: 
(This isn't contradictory either, it just seems that way to your minds.) 


You See, The Netherworld is divided into Dark & Light.
The Dead in the Dark/Void and the Dead in the Light/Kingdom have their own consciousness.



"The Dark Rises and the Light must rise with it." — Snoke (while alive)


Hence, Jedi vs. Siths 
A WAR IN THE MAKING.


"And also, logic and reason doesn't happen there. Based on the sum total of all my intelligence thoughts that I've learned. It's like getting constant Revelations." - Mickey Robinson.



So, Luke Skywalker is out there (Lost) in The Force getting constant Revelations.

Yoda was able to summon lightning from the Sky.

Sound Familiar? 

Any Biblical Scholar should know 
Who in the world could do just that.

But that's not the important part. 


Yoda summons lightning from the Sky using the Force an ability that's was previously unheard of. Therefore, there's some new-knowledge that Luke Skywalker will be learning while inside this FORCE to bring in Star Wars Episode 9 to a close.


But that's not all! The Siths also want this Knowledge. 

Sound Familiar? It should.



"The Dark Rises and the Light must rise with it." — Snoke


And there's more: 

Snoke may not be dead at all. 
In fact, much like Skywalker's power to transcend. 
He too could move His Evil Self from his Vessel.


Now for the REVEAL!

"Into the Force" is actually, in reality, into the Spirit World. 
Egyptian Pharaohs once achieved it, God in the flesh achieved it, and now there may be a door opened for us Humans to achieve it.
How do you think SP was able to come up with this conclusion. 


Star Wars (the franchised) mimic God's Word then 
and it may be doing so now.


- WATCH VIDEO -



In 1 Corinthians 8:6 We hear that: yet for us there is but one God, the Father, from whom all things came and for whom we live; and there is but one Lord, Jesus Christ, through whom all things came and through whom we live.








Get Your 2018 Membership!



(2017) Into The Force Keywords: Phantom Menace, Into the Force Realm, Star Wars Forces, Star Wars Episode VIII Ending, Spoiler, Luke Skywalker, Yoda, Star Wars IX, Darkness Light, Sith, Jedi, Star Wars Last Jedi

Sunday, November 26, 2017

Topics: , , , , , , ,

Dark Matter Spiritual Realm

THIS POST WILL EXPLAIN AND REVEAL THE DARK MATTER REALM TO THE WORLD.


Dark matter is a hypothetical type of matter distinct from baryonic matter (ordinary matter such as protons and neutrons), neutrinos and dark energy.  Dark matter has never been directly observed; however, its existence would explain a number of otherwise puzzling astronomical observations. It does not emit or interact with observable electromagnetic radiation, such as light, and is thus invisible to the entire electromagnetic spectrum. But what is this substance that cloaks our physical world? Does the purpose for its creation have something to do with Spirits? And if so, does it itself hide a secret of the spiritual world unknown to man?



- W  H  I  T  E      M  I  R  R  O  R -
-  R  E  V  E  A  L  -

DARK MATTER SPIRITUAL REALM


"The mystery of Dark Matter deepens . . ." 


"This Reveal comes in three and ends with the Matrix Discovery." 


"One invisible kind of particle consumes our world and their world solely to conceal."

 
Is our world a simulation? Why some scientists say it's more likely than not 
[source]
 
A swath of technologists and physicists believe that ‘simulation theory’ will be proved, just as it was proved that the Earth was not the center of the universe.

Musk is just one of the people in Silicon Valley to take a keen interest in the “simulation hypothesis”, which argues that what we experience as reality is actually a giant computer simulation created by a more sophisticated intelligence; a GOD.

If it sounds a lot like The Matrix, that’s because it is.


READ ▶ The Matrix World Revealed

&

 READ The Human Matrix 




CLAIM #1 
Dark Matter is a substance that inhabits the Spiritual World outside the Kingdom of GOD.


The light (Kingdom of GOD) shines in the darkness, and the darkness has not overcome it - John 1:5.


IF TRUE, WHAT DOES THIS MEAN?
It means there's a new undiscovered matter that surrounds GOD's Kingdom and it "repels" Dark Matter but it's not Earthly Matter either.

Two years ago several of my Sci Am colleagues and I had an intense email exchange over a period of weeks, trying to figure out what to make of a new paper by string theorist Erik Verlinde. I don’t think I’ve ever been so flummoxed by physicists’ reactions to a paper.

I couldn’t decide whether it was profound or trite. The theorists we consulted said they couldn’t follow it, which we took as a polite way of saying that their colleague had gone off the deep end. Some physics bloggers came out and called Verlinde a crackpot. 
[source: Scientific American]





CLAIM #2 
Dark Matter is a heavy dense substance in that Realm, so heavy that when a Spirit enters its presence it's immediately consumed by mass (e.g. heaviness). 


SCIENCE: Dark matter as we understand it must be some kind of particle, or at least act like some kind of particle. We’re not exactly clear on what the exact nature of that particle would be, or what its individual mass is, or what kind of interactions it ought to have either with itself or with the matter that makes up our planet and all the stars.


ASTRAL PROJECTION & WHAT PEOPLE SAY: 

Astral Projection: "And I couldn't move, I could barely move." 

Sleep Paralysis: "I felt heavy." 

Hell Witness: "There was weight on me in (this place) Hell. . . "


CLAIM #3
Humans cannot interact with Dark Matter and it's dark-environment until the gateway between the two worlds is opened.


SCIENCE: Causes. During rapid eye movement (REM) sleep the brain has vivid dreams, while the muscles of the body are essentially turned off. ... Several things can bring on episodes of sleep paralysis. For example, sleep deprivation, some medications and some sleep disorders, such as sleep apnea, are triggers.


The world is unaware or oblivious to the fact, that medications in God's eyes are Sorceries. Since they replace his power with potions.


Interesting Tidbit To Know: 
The word Pharmacy comes from the word Pharmakia, which means Sorcery. So that's why it's a cause of Sleep Paralysis, because the person (In God's Eyes) practiced a small dosage of Sorcery.


Sleep Deprivation is essentially the Human Soul having low energy to fight off the Darkness at night.
It NEEDS sleep to recharge.
 

pharmakeía (from pharmakeuō, "administer drugs") – properly, drug-related sorcery, like the practice of magical-arts, etc.


CLAIM #4
DURING Sleep Paralysis a Human's Soul/Spirit depending on the doorway that opens, 
is instantaneously "transported" to this Realm and cannot move. 


It's so real and vivid that people believe they are being "literally" abducted.


Alien Abduction? Science Calls It Sleep Paralysis 
[source: NYTimes]

About once a week, Jean-Christophe Terrillon wakes up and senses the presence of a threatening, evil being beside his bed. Terror ripples through him, and he tries to move or call out.  But he is paralyzed, unable to raise an arm or make a sound. His ears ring, a weight presses down on his chest, and he has to struggle for breath.

 
So, no you're not in a Spaceship during Sleep Paralysis or even somewhere in Space.
You're in another world in another side of our Universe, of pure-Darkness.


Transported: cause (someone) to feel that they are in another place or time.



- WATCH VIDEO -



0:58 - The gravity of the visible matter is not strong enough to form galaxies and complex structures. The stars would more likely be scattered all over the place and not form galaxies. So, we know there is something else inside and around them, something that doesn't emit or reflect light. Something dark . . .


CLAIM #5 
It is not impossible to move during Sleep Paralysis, I've done it. 
All that It's required is a strong spirit.


Energy of the Spirit allows you to move "freely" in that Realm.


In other words: What's Flesh is of the Flesh and What's Spirit is of the Spirit/Soul.
weak/strong Spirits move differently in that realm.



CLAIM #6 
DARK MATTER IS HIDING SOMETHING.


Dark Matter is the stuff that makes it possible for Galaxies to exist.

"Everything we experience is really only a tiny fraction of reality." 


Cloaking: hide, cover, or disguise (something).



Get Your 2018 Membership!

Listen to SP